circad | circRNAs associated with diseases

hsa_circ_0054633
Gene	PNPT1	Organism	Human
Genome Locus	chr2:55861197-55913579:-	Build	hg19
Disease	Pre-diabetes and type 2 Diabetes mellitus	ICD-10	Type 2 diabetes mellitus (E11)
DBLink	Link to database	PMID	27878383
Experimental Method
Sample Type	Blood samples	Comparison	Control (n=20), Pre-diabetes (n=20), T2DM (n=20)
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TTGCTTTCTACACTTTCAGGTGAC Reverse GCTTTTTGTCTGTAGTCAACCACCA	Statistics	Fold Change : Upregulated pvalue : p=0.007
Citation
Zhao, Z, Li, X, Jian, D, Hao, P, Rao, L, Li, M (2017). Hsa_circ_0054633 in peripheral blood can be used as a diagnostic biomarker of pre-diabetes and type 2 diabetes mellitus. Acta Diabetol, 54, 3:237-245.